Orphan drugs are intended to treat diseases so rare that sponsors are reluctant to develop them under usual marketing conditions. They may be defined as drugs that are not developed by the pharmaceutical industry for economic reasons but which respond to public health need. The indications of a drug may also be considered as ' orphan ' since a substance may be used in the treatment of a frequent disease but may not have been developed for another, more rare indication.
An orphan designation allows a pharmaceutical company to benefit from incentives from the European Union to develop a medicine for a rare disease, such as reduced fees and protection from competition once the medicine is placed on the market. Applications for orphan designation are examined by the COMP (Committee for Orphan Medicinal Products), which adopts an opinion that is forwarded to the European Commission. The European Commission then decides whether to grant an orphan designation for the medicine in question.
Rare eye disorders have a significant health impact as more than 60 % of childhood cases of blindness are due to congenital cataracts and glaucoma, retinal degenerations, optic atrophy, and eye malformations. Some of the rare retinal diseases such as retinitis pigmentosa, Usher syndrome (a deaf–blindness condition), Stargardt's disease, Leber's congenital amaurosis, etc., are within the main scientific interests of the Institut de la Vision.
Sources : Orphanet, European Medicines Agency
Inventory of orphan drug designations for treatment of eye diseases
From the Community Register of orphan medicinal products for human use
-
Retinitis pigmentosa
Active substance 4,7,10,13,16,19-docosahexaenoic acid Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 03/11/2006 Outcome Positive Orphan decision number EU/3/06/412 Sponsor: Natac Pharma S.L.
C/ Faraday 7, 28049 Madrid, EspañaActive substance 9-cis-Retinyl acetate Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 13/05/2011 Outcome Positive Orphan decision number EU/3/11/865 Sponsor: QLT Ophthalmics (UK), Ltd
c/o Hackwood Secretaries Limited, One Silk Street, London EC2Y 8HQ, United KingdomActive substance Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene Medicine Name Disease/condition Treatment of rhodopsin-linked retinitis pigmentosa Date of decision 17/12/2010 Outcome Positive Orphan decision number EU/3/10/817 Sponsor: Genable Technologies Ltd
Smurfit Institute of Genetics, Trinity College Dublin, Dublin 2, IrelandActive substance Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 13/11/2007 Outcome Positive Orphan decision number EU/3/07/486 Sponsor: HORAMA SAS
9 rue de l'Eperon, 75006 Paris, FranceActive substance adenovirus associated viral vector serotype 5 containing the human pde6β gene Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 19/06/2013 Outcome Positive Orphan decision number EU/3/13/1142 Sponsor: HORAMA SAS
9 rue de l'Eperon, 75006 Paris, FranceActive substance Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 28/07/2015 Outcome Positive Orphan decision number EU/3/15/1518 Sponsor: Alan Boyd Consultants Ltd
Electra House, Crewe Business Park, Crewe, Cheshire CW1 6GL, United KingdomActive substance Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 24/01/2013 Outcome Positive Orphan decision number EU/3/12/1098 Sponsor: Enpharma Ltd
North House, Farmoor Court, Cumnor Road, Oxford, OX2 9LU, United KingdomActive substance expanded human allogeneic neural retinal progenitor cells extracted from neural retina Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 19/06/2013 Outcome Positive Orphan decision number EU/3/13/1140 Sponsor: ReNeuron Ltd
10 Nugent Road, Surrey Research Park, Guildford GU2 7AF, Surrey, United KingdomActive substance Recombinant human methionine proinsulin Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 26/04/2012 Outcome Positive Orphan decision number EU/3/12/985 Sponsor: ProRetina Therapeutics S.L.
Plaza Cein, 5, Despacho T5, E-31110 Noáin (Navarra), EspañaActive substance Recombinant human mesencephalic astrocyte-derived neurotrophic factor Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 24/04/2015 Outcome Positive Orphan decision number EU/3/15/1486 Sponsor: Clinipace GmbH
Landsbergerstrasse 408, 81241 München, DeutschlandActive substance Recombinant human nerve growth factor Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 07/06/2013 Outcome Positive Orphan decision number EU/3/13/1135 Sponsor: Dompé farmaceutici s.p.a.
Via Santa Lucia 6, 20122 Milano, ItaliaActive substance Recombinant human proinsulin Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 10/02/2009 Outcome Positive Orphan decision number EU/3/08/612 Sponsor: ProRetina Therapeutics S.L.
Plaza Cein, 5, Despacho T5, E-31110 Noáin (Navarra), EspañaActive substance Sodium 3-[(4aR,6R,7R,7aS)-7-hydroxy-2-oxido-2-sulfanylidene-4a,6,7,7a-tetrahydro-4H-furo [3,2-d][1,3,2] dioxaphosphinin-6-yl]-2-bromo-6-phenyl-5H-imidazo[1,2-a]purin-9-one Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 19/03/2015 Outcome Positive Orphan decision number EU/3/15/1462 Sponsor: Universitätsklinikum Tübingen (UKT)
Geissweg 3, 72076 Tübingen, DeutschlandActive substance unoprostone isopropyl Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 19/06/2013 Outcome Positive Orphan decision number EU/3/13/1146 Sponsor: Wainwright Associates Limited
Wessex House, Marlow Road, Bourne End, Buckinghamshire SL8 5SP, United KingdomActive substance 4-[(2E)-1-oxo-3-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2-propen-1-yl]-1-piperazinecarboxamide Medicine name Disease/condition Treatment of retinitis pigmentosa Date of decision 30/05/2016 Outcome Positive Ophan decision number EU/3/16/1658 Active substance Allogeneic fetal human retinal progenitor cells expanded ex vivo Medicine name Disease/condition Treatment of retinitis pigmentosa Date of decision 17/02/2016 Outcome Positive Ophan decision number EU/3/16/1620 Active substance Recombinant adeno-associated viral vector containing the human RPGR gene Medicine name Disease/condition Treatment of retinitis pigmentosa caused by mutations in the RPGR gene Date of decision 30/05/2016 Outcome Positive Ophan decision number EU/3/16/1665 Active ingredient Antisense oligonucleotide targeting the USH2A gene EU orphan designation number EU/3/17/1853 Indication Treatment of retinitis pigmentosa Sponsor ProQR Therapeutics IV BV
Zernikedreef 9, 2333 CK Leiden, NederlandActive substance Recombinant truncated N-terminal fragment of human lens epithelium-derived growth factor Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 23/08/2017 Outcome Positive Orphan decision number EU/3/17/1908 -
Usher syndrome
Active substance Lentiviral vector containing the human MYO7A gene Medicine Name Disease/condition Treatment of retinitis pigmentosa in Usher syndrome 1B Date of decision 23/03/2010 Outcome Positive Orphan decision number EU/3/10/727 Sponsor: Sanofi-Aventis groupe
54 rue La Boétie, F-75008 Paris, FranceActive substance Mixture of two adeno-associated viral vectors serotype 8 containing the 5’-half sequence of human MYO7A gene and the 3’-half sequence of human MYO7A gene Medicine Name Disease/condition Treatment of Usher syndrome Date of decision 04/07/2014 Outcome Positive Orphan decision number EU/3/14/1282 Sponsor: Fondazione Telethon
Via Varese 16, 00185 Roma, Italia -
Stargardt's disease
Active substance Ecothiopate iodide Medicine Name Disease/condition Treatment of Stargardt’s disease Date of decision 24/04/2015 Outcome Positive Orphan decision number EU/3/15/1474 Sponsor: JJGConsultancy Ltd
Sherston House, High Street, Evercreech, Somerset BA4 6HZ, United KingdomActive substance Lentiviral vector containing the human ABCA4 gene Medicine Name Disease/condition Treatment of Stargardt’s disease Date of decision 02/02/2010 Outcome Positive Orphan decision number EU/3/09/720 Sponsor: Sanofi-Aventis groupe
54 rue La Boétie, F-75008 Paris, FranceActive substance Mixture of two adeno-associated viral vectors of serotye 8 containing the 5’-half sequence of human ABCA4 gene and the 3’-half sequence of human ABCA4 gene Medicine Name Disease/condition Treatment of Stargardt's disease Date of decision 04/07/2014 Outcome Positive Orphan decision number EU/3/14/1283 Sponsor: Fondazione Telethon
Via Varese 16, 00185 Roma, ItaliaActive substance Ramiprilat Medicine Name Disease/condition Treatment of Stargardt’s disease Date of decision 12/03/2013 Outcome Positive Orphan decision number EU/3/13/1117 Sponsor: Iris Pharma
Les Nertières, allée Hector Pintus, F-06610 La Gaude, FranceActive substance Soraprazan Medicine Name Disease/condition Treatment of Stargardt’s disease Date of decision 13/11/2013 Outcome Positive Orphan decision number EU/3/13/1208 Sponsor: Katairo GmbH
Lederstrasse 21, 72127 Kusterdingen, DeutschlandActive substance Antisense oligonucleotide targeting exon 13 in the USH2A gene Medicine Name Disease/condition Treatment of retinitis pigmentosa Date of decision 23/08/2017 Outcome Positive Orphan decision number EU/3/17/1899 -
Achromatopsia
Active substance Recombinant adeno-associated viral vector expressing the human CNGA3 gene Medicine Name Disease/condition Treatment of achromatopsia caused by mutations in the CNGA3 gene Date of decision 09/10/2015 Outcome Positive Orphan decision number EU/3/15/1556 Sponsor: TMC Pharma Services Ltd
Lodge Farm Barn, Elvetham Park Estate, Fleet Road, Hartley Wintney, Hampshire RG27 8AS, United KingdomActive substance Recombinant adeno-associated viral vector containing the human CNGB3 gene Medicine Name Disease/condition Treatment of achromatopsia caused by mutations in the CNGB3 gene Date of decision 08/02/2013 Outcome Positive Orphan decision number EU/3/13/1099 Sponsor: TMC Pharma Services Ltd
Lodge Farm Barn, Elvetham Park Estate, Fleet Road, Hartley Wintney, Hampshire RG27 8AS, United Kingdom -
Optic neuritis
Active substance N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)-propyl]-carbamoyl}-methyl)-2-[2-(2-fluoro-phenyl)-ethylamino]-N-isobutyl-acetamide Medicine Name Disease/condition Treatment of optic neuritis Date of decision 31/03/2014 Outcome Positive Orphan decision number EU/3/14/1248 Sponsor Bionure Farma SL
Dalmases 27, Local 1, 08017 Barcelona, EspañaActive substance Humanised anti-IL-6 receptor monoclonal antibody Medicine Name Disease/condition Treatment of neuromyelitis optica spectrum disorders Date of decision 27/06/2016 Outcome Positive Orphan decision number EU/3/16/1680
Active substance Eculizumab Medicine Name Disease/condition Treatment of neuromyelitis optica Date of decision 05/08/2013 Outcome Positive Orphan decision number EU/3/13/1185 Active ingredient Inebilizumab EU orphan designation number EU/3/17/1856 Indication Treatment of neuromyelitis optica spectrum disorders Sponsor AstraZeneca AB
SE-151 85 Södertälje, Sverige -
Leber's hereditary optic neuropathy
Active substance Adeno-associated viral vector containing the human NADH-dehydrogenase-4 gene Medicine Name Disease/condition Treatment of Leber's hereditary optic neuropathy Date of decision 13/05/2011 Outcome Positive Orphan decision number EU/3/11/860 Sponsor: GenSight- Biologics
74 rue du Faubourg Saint-Antoine, 75012 Paris, FranceActive substance Idebenone Medicine Name Disease/condition Treatment of Leber's hereditary optic neuropathy Date of decision 15/02/2007 Outcome Positive Orphan decision number EU/3/07/434 EU Centralised marketing authorisation: A centralised EU marketing authorisation has been obtained under the name Raxone on 08/09/2015 with the number EU/1/15/1020 Sponsor: Santhera Pharmaceuticals (Deutschland) GmbH
Marie-Curie Strasse 24, D-79539 Lörrach, Deutschland -
Leber's congenital amaurosis
Active substance 9-cis-Retinyl acetate Medicine Name Disease/condition Treatment of Leber’s congenital amaurosis Date of decision 13/05/2011 Outcome Positive Orphan decision number EU/3/11/861 Sponsor: QLT Ophthalmics (UK), Ltd
c/o Hackwood Secretaries Limited, One Silk Street, London EC2Y 8HQ, United KingdomActive substance Adeno-associated viral vector serotype 8 containing the human GUCY2D gene Medicine Name Disease/condition Treatment of Leber’s congenital amaurosis Date of decision 26/03/2014 Outcome Positive Orphan decision number EU/3/14/1256 Sponsor: Fondazione Telethon
Via Varese 16, 00185 Roma, ItaliaActive substance Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene Medicine Name Disease/condition Treatment of Leber’s congenital amaurosis Date of decision 02/04/2012 Outcome Positive Orphan decision number EU/3/12/981 Sponsor: Alan Boyd Consultants Ltd
Electra House, Crewe Business Park, Crewe, Cheshire CW1 6GL, United KingdomActive substance Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Medicine Name Disease/condition Treatment of leber's congenital amaurosis Date of decision 22/10/2007 Outcome Positive Orphan decision number EU/3/07/484 Sponsor: HORAMA SAS
9 rue de l'Eperon, 75006 Paris, FranceEU orphan designation number: EU/3/15/1577 Active ingredient: Adenovirus associated viral vector serotype 5 containing the human RPE65 gene Indication: Treatment of Leber’s congenital amaurosis Sponsor: Athena Vision Ltd
c/o UCL Business PLC The Network Building, 97 Tottenham Court Road, London W1T 4TP, United KingdomActive substance Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA Medicine name Disease / condition Treatment of Leber’s congenital amaurosis Date of decision 28/04/2016 Outcome Positive Orphan decision number EU/3/16/1641 Active substance Recombinant adeno-associated viral vector serotype 5 encoding Staphylococcus aureus Cas9 endonuclease and two guide RNAs complementary to two regions of intron 26 of the CEP290 gene Medicine name Disease / condition Treatment of Leber’s congenital amaurosis Date of decision 6/10/2017 Sponsor Pharma Gateway AB
Johanneslundsvägen 2, Oxfordhuset, 194 61 Upplands Väsby, SverigeOrphan decision number EU/3/17/1928 -
Uveitis
Active substance 3-{[2,3,5,6-tetrafluoro-3'-(trifluoromethoxy)biphenyl-4-yl]carbamoyl}thiophene-2-carboxylic acid Medicine Name Disease/condition Treatment of non-infectious uveitis Date of decision 19/06/2015 Outcome Positive Orphan decision number EU/3/15/1507 Sponsor: Panoptes Pharma Ges.m.b.H
Am Heumarkt 7/39, 1030 Vienna, ÖsterreichActive substance Autologous collagen type II-specific regulatory T cells Medicine Name Disease/condition Treatment of non-infectious uveitis Date of decision 16/12/2014 Outcome Positive Orphan decision number EU/3/14/1405 Sponsor: TxCell
Allée de la Nertière - Les Cardoulines, F-06560 Valbonne - Sophia Antipolis, FranceActive substance Fluocinolone acetonide (prolonged-release intravitreal implant) Medicine Name Disease/condition Treatment of non-infectious uveitis affecting the posterior segment of the eye Date of decision 06/03/2005 Outcome Positive Orphan decision number EU/3/05/261 Sponsor: Bausch & Lomb Ireland
IDA Industrial Park, Waterford, IrelandActive substance Gevokizumab Medicine Name Disease/condition Treatment of chronic non-infectious uveitis Date of decision 12/03/2013 Outcome Positive Orphan decision number EU/3/13/1111 Sponsor: Les Laboratoires Servier
50 rue Carnot, F-92284 Suresnes CEDEX, FranceActive substance Sirolimus Medicine Name Disease/condition Treatment of chronic non-infectious uveitis Date of decision 30/08/2011 Outcome Positive Orphan decision number EU/3/11/898 Active substance Triamcinolone acetonide Medicine Name Disease/condition Treatment of non-infectious uveitis Date of decision 21/05/2015 Outcome Positive Orphan decision number EU/3/15/1490 Sponsor: S-cubed Ltd
99 Park Drive, Milton Park, Abingdon, Oxfordshire OX14 4RY, United KingdomActive substance Voclosporin Medicine Name Disease/condition Treatment of non-infectious uveitis Date of decision 06/12/2012 Outcome Positive Orphan decision number EU/3/12/1085 Sponsor: Granzer Regulatory Consulting & Services
Zielstattstr. 44, D-81379 Munich, DeutschlandActive substance DNA plasmid encoding a recombinant fusion protein consisting of the extracellular domain of human TNFα p55 receptor linked to the human IgG1 Fc domain Medicine name Disease / condition Treatment of non-infectious uveitis Date of decision 17/02/2016 Outcome Positive Orphan decision number EU/3/16/1619 Active substance Fluocinolone acetonide Medicine name Disease / condition Treatment of non-infectious uveitis Date of decision 28/04/2016 Outcome Positive Orphan decision number EU/3/16/1647 -
Others
Active substance (1S,4R,5R,7S)-3,4-dibenzyl-2-oxo-6,8-dioxa-3-azabyciclo[3.2.1]octane-7-carboxylic acid-L-lysine Medicine Name Disease/condition Treatment of neurotrophic keratitis Date of decision 16/12/2014 Outcome Positive Orphan decision number EU/3/14/1400 Sponsor: MIMETECH S.r.l.
Via di Vigna Stelluti 157, 0091 Roma, ItaliaActive substance 4-(4-Methoxy-phenylamino)-6-methylcarbamyl-quinoline-3-carboxylic acid Medicine Name Disease/condition Prevention of scarring post glaucoma filtration surgery Date of decision 04/06/2014 Outcome Positive Orphan decision number EU/03/14/1279 Sponsor: Clanotech AB
Fogdevreten 2, Solna S-171 65, SverigeActive substance Adeno-associated viral vector serotype 2 containing the human REP1 gene Medicine Name Disease/condition Treatment of choroideraemia Date of decision 04/07/2014 Outcome Positive Orphan decision number EU/3/14/1290 Sponsor: NightstaRx Ltd.
215 Euston Road, London NW1 2BE, United KingdomActive substance Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1 Medicine Name Disease/condition Treatment of choroideraemia Date of decision 04/06/2014 Outcome Positive Orphan decision number EU/03/14/1278 Sponsor: Alan Boyd Consultants Ltd
Electra House, Crewe Business Park, Crewe, Cheshire CW1 6GL, United KingdomActive substance Adeno-associated viral vector serotype 5 containing the human CHM gene Medicine Name Disease/condition Treatment of choroideremia Date of decision 24/04/2015 Outcome Positive Orphan decision number EU/3/15/1482 Sponsor: HORAMA SAS
9 rue de l'Eperon, 75006 Paris, FranceActive substance Aganirsen Medicine Name Disease/condition Treatment of central retinal vein occlusion Date of decision 10/06/2014 Outcome Positive Orphan decision number EU/03/14/1275 Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, F-91000 Evry, FranceActive substance Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Medicine Name Disease/condition Prevention of corneal graft rejection Date of decision 17/04/2007 Outcome Positive Orphan decision number EU/3/07/445 Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, F-91000 Evry, FranceActive substance Ciclosporin Medicine Name Disease/condition Prevention of corneal graft rejection Date of decision 22/10/2007 Outcome Positive Orphan decision number EU/3/07/455 Sponsor: SANTEN SAS
Bât Genavenir IV, 1 rue Pierre Fontaine, F- 91058 Evry CEDEX, FranceActive substance Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Medicine Name Disease/condition Treatment of retinopathy of prematurity Date of decision 02/10/2003 Outcome Positive Orphan decision number EU/3/03/160 Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, F-91000 Evry, FranceActive substance Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Medicine Name Disease/condition Treatment of neovascular glaucoma Date of decision 02/10/2003 Outcome Positive Orphan decision number EU/3/03/161 Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, F-91000 Evry, FranceActive substance Ataluren Medicine Name Disease/condition Treatment of aniridia Date of decision 09/10/2015 Outcome Positive Orphan decision number EU/3/15/1561 Sponsor: PTC Therapeutics International Limited
77 Sir John Rogerson’s Quay, Dublin 2, IrelandActive substance Ciclosporin Medicine Name Disease/condition Treatment of vernal keratoconjunctivitis Date of decision 06/04/2006 Outcome Positive Orphan decision number EU/3/06/360 Sponsor: SANTEN SAS
Bât Genavenir IV, 1 rue Pierre Fontaine, F- 91058 Evry CEDEX, FranceActive substance Ciclosporin (eye drops, solution) Medicine Name Disease/condition Treatment of atopic keratoconjunctivitis Date of decision 24/07/2009 Outcome Positive Orphan decision number EU/3/09/651 Sponsor: Allergan Pharmaceuticals Ireland
Castlebar Road, Westport, County Mayo, IrelandActive substance Ciclosporin Medicine Name Disease/condition Treatment of herpes simplex virus stromal keratitis Date of decision 28/10/2007 Outcome Positive Orphan decision number EU/3/07/489 Sponsor: SANTEN S.A.S.
Bâtiment Genavenir IV, 1 rue Pierre Fontaine, F-91058 Evry Cedex, FranceActive substance Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotropic factor Medicine Name Disease/condition Treatment of macular telangiectasia type 2 Date of decision 08/11/2012 Outcome Positive Orphan decision number EU/3/12/1072 Sponsor: Enpharma Ltd
North House, Farmoor Court, Cumnor Road, Oxford, OX2 9LU, United KingdomActive substance Ex-vivo-expanded autologous human corneal epithelium-containing stem cells Medicine Name Holoclar Disease/condition Corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns Date of decision 06/11/2008 Outcome Positive Orphan decision number EU/3/08/579 Sponsor: Chiesi Farmaceutici S.P.A.
Via Palermo 26/A, 43122 Parma, ItaliaEU Centralised marketing authorisation: A centralised EU marketing authorisation has been obtained under the name Holoclar on 17/02/2015 with the number EU/1/14/987 Active substance Mecasermin rinfabate Medicine Name Disease/condition Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Date of decision 28/08/2006 Outcome Positive Orphan decision number EU/3/06/399 Sponsor: Premacure AB
Dag Hammarskjölds väg 60, SE-751 83 Uppsala, SverigeEU orphan designation number: EU/3/15/1586 Active ingredient: Recombinant human nerve growth factor Indication: Treatment of neurotrophic keratitis Sponsor: Dompé farmaceutici S.p.A.
Via San Martino, 12-12/a, 20122 Milano, ItaliaActive substance Retinol Medicine Name Disease/condition Prevention of retinopathy of prematurity Date of decision 17/07/2017 Outcome Positive Orphan decision number EU/3/17/1895 Active substance Inebilizumab Medicine Name Disease/condition Treatment of neuromyelitis optica spectrum disorders Date of decision 20/03/2017 Outcome Positive Orphan decision number EU/3/17/1856