Orphan drugs are intended to treat diseases so rare that sponsors are reluctant to develop them under usual marketing conditions. They may be defined as drugs that are not developed by the pharmaceutical industry for economic reasons but which respond to public health need. The indications of a drug may also be considered as ' orphan ' since a substance may be used in the treatment of a frequent disease but may not have been developed for another, more rare indication.

An orphan designation allows a pharmaceutical company to benefit from incentives from the European Union to develop a medicine for a rare disease, such as reduced fees and protection from competition once the medicine is placed on the market. Applications for orphan designation are examined by the COMP (Committee for Orphan Medicinal Products), which adopts an opinion that is forwarded to the European Commission. The European Commission then decides whether to grant an orphan designation for the medicine in question. 

Rare eye disorders have a significant health impact as more than 60 % of childhood cases of blindness are due to congenital cataracts and glaucoma, retinal degenerations, optic atrophy, and eye malformations. Some of the rare retinal diseases such as retinitis pigmentosa, Usher syndrome (a deaf–blindness condition), Stargardt's disease, Leber's congenital amaurosis, etc., are within the main scientific interests of the Institut de la Vision.

Sources : Orphanet, European Medicines Agency

Inventory of orphan drug designations for treatment of eye diseases

From the Community Register of orphan medicinal products for human use

• Retinitis pigmentosa

   

  Active substance	4,7,10,13,16,19-docosahexaenoic acid
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	03/11/2006
  Outcome	Positive
  Orphan decision number	EU/3/06/412
  Sponsor:	Natac Pharma S.L. C/ Faraday 7, 28049 Madrid, España

   

  Active substance	9-cis-Retinyl acetate
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	13/05/2011
  Outcome	Positive
  Orphan decision number	EU/3/11/865
  Sponsor:	QLT Ophthalmics (UK), Ltd c/o Hackwood Secretaries Limited, One Silk Street, London EC2Y 8HQ, United Kingdom

   

  Active substance	Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene
  Medicine Name
  Disease/condition	Treatment of rhodopsin-linked retinitis pigmentosa
  Date of decision	17/12/2010
  Outcome	Positive
  Orphan decision number	EU/3/10/817
  Sponsor:	Genable Technologies Ltd Smurfit Institute of Genetics, Trinity College Dublin, Dublin 2, Ireland

   

  Active substance	Adenovirus associated viral vector serotype 4 containing the human RPE65 gene
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	13/11/2007
  Outcome	Positive
  Orphan decision number	EU/3/07/486
  Sponsor:	HORAMA SAS 9 rue de l'Eperon, 75006 Paris, France

   

  Active substance	adenovirus associated viral vector serotype 5 containing the human pde6β gene
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	19/06/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1142
  Sponsor:	HORAMA SAS 9 rue de l'Eperon, 75006 Paris, France

   

  Active substance	Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	28/07/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1518
  Sponsor:	Alan Boyd Consultants Ltd Electra House, Crewe Business Park, Crewe, Cheshire CW1 6GL, United Kingdom

   

  Active substance	Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	24/01/2013
  Outcome	Positive
  Orphan decision number	EU/3/12/1098
  Sponsor:	Enpharma Ltd North House, Farmoor Court, Cumnor Road, Oxford, OX2 9LU, United Kingdom

   

  Active substance	expanded human allogeneic neural retinal progenitor cells extracted from neural retina
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	19/06/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1140
  Sponsor:	ReNeuron Ltd 10 Nugent Road, Surrey Research Park, Guildford GU2 7AF, Surrey, United Kingdom

   

  Active substance	Recombinant human methionine proinsulin
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	26/04/2012
  Outcome	Positive
  Orphan decision number	EU/3/12/985
  Sponsor:	ProRetina Therapeutics S.L. Plaza Cein, 5, Despacho T5, E-31110 Noáin (Navarra), España

   

  Active substance	Recombinant human mesencephalic astrocyte-derived neurotrophic factor
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	24/04/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1486
  Sponsor:	Clinipace GmbH Landsbergerstrasse 408, 81241 München, Deutschland

   

  Active substance	Recombinant human nerve growth factor
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	07/06/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1135
  Sponsor:	Dompé farmaceutici s.p.a. Via Santa Lucia 6, 20122 Milano, Italia

   

  Active substance	Recombinant human proinsulin
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	10/02/2009
  Outcome	Positive
  Orphan decision number	EU/3/08/612
  Sponsor:	ProRetina Therapeutics S.L. Plaza Cein, 5, Despacho T5, E-31110 Noáin (Navarra), España

   

  Active substance	Sodium 3-[(4aR,6R,7R,7aS)-7-hydroxy-2-oxido-2-sulfanylidene-4a,6,7,7a-tetrahydro-4H-furo [3,2-d][1,3,2] dioxaphosphinin-6-yl]-2-bromo-6-phenyl-5H-imidazo[1,2-a]purin-9-one
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	19/03/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1462
  Sponsor:	Universitätsklinikum Tübingen (UKT) Geissweg 3, 72076 Tübingen, Deutschland

   

  Active substance	unoprostone isopropyl
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	19/06/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1146
  Sponsor:	Wainwright Associates Limited Wessex House, Marlow Road, Bourne End, Buckinghamshire SL8 5SP, United Kingdom

   

  Active substance	4-[(2E)-1-oxo-3-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2-propen-1-yl]-1-piperazinecarboxamide
  Medicine name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	30/05/2016
  Outcome	Positive
  Ophan decision number	EU/3/16/1658

   

   

   

   

   

   

   

  Active substance	Allogeneic fetal human retinal progenitor cells expanded ex vivo
  Medicine name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	17/02/2016
  Outcome	Positive
  Ophan decision number	EU/3/16/1620

   

  Active substance	Recombinant adeno-associated viral vector containing the human RPGR gene
  Medicine name
  Disease/condition	Treatment of retinitis pigmentosa caused by mutations in the RPGR gene
  Date of decision	30/05/2016
  Outcome	Positive
  Ophan decision number	EU/3/16/1665

   

  Active ingredient	Antisense oligonucleotide targeting the USH2A gene
  EU orphan designation number	EU/3/17/1853
  Indication	Treatment of retinitis pigmentosa
  Sponsor	ProQR Therapeutics IV BV Zernikedreef 9, 2333 CK Leiden, Nederland

   

  Active substance	Recombinant truncated N-terminal fragment of human lens epithelium-derived growth factor
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	23/08/2017
  Outcome	Positive
  Orphan decision number	EU/3/17/1908

• Usher syndrome

  Active substance	Lentiviral vector containing the human MYO7A gene
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa in Usher syndrome 1B
  Date of decision	23/03/2010
  Outcome	Positive
  Orphan decision number	EU/3/10/727
  Sponsor:	Sanofi-Aventis groupe 54 rue La Boétie, F-75008 Paris, France

   

  Active substance	Mixture of two adeno-associated viral vectors serotype 8 containing the 5’-half sequence of human MYO7A gene and the 3’-half sequence of human MYO7A gene
  Medicine Name
  Disease/condition	Treatment of Usher syndrome
  Date of decision	04/07/2014
  Outcome	Positive
  Orphan decision number	EU/3/14/1282
  Sponsor:	Fondazione Telethon Via Varese 16, 00185 Roma, Italia

• Stargardt's disease

  Active substance	Ecothiopate iodide
  Medicine Name
  Disease/condition	Treatment of Stargardt’s disease
  Date of decision	24/04/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1474
  Sponsor:	JJGConsultancy Ltd Sherston House, High Street, Evercreech, Somerset BA4 6HZ, United Kingdom

   

  Active substance	Lentiviral vector containing the human ABCA4 gene
  Medicine Name
  Disease/condition	Treatment of Stargardt’s disease
  Date of decision	02/02/2010
  Outcome	Positive
  Orphan decision number	EU/3/09/720
  Sponsor:	Sanofi-Aventis groupe 54 rue La Boétie, F-75008 Paris, France

   

  Active substance	Mixture of two adeno-associated viral vectors of serotye 8 containing the 5’-half sequence of human ABCA4 gene and the 3’-half sequence of human ABCA4 gene
  Medicine Name
  Disease/condition	Treatment of Stargardt's disease
  Date of decision	04/07/2014
  Outcome	Positive
  Orphan decision number	EU/3/14/1283
  Sponsor:	Fondazione Telethon Via Varese 16, 00185 Roma, Italia

   

  Active substance	Ramiprilat
  Medicine Name
  Disease/condition	Treatment of Stargardt’s disease
  Date of decision	12/03/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1117
  Sponsor:	Iris Pharma Les Nertières, allée Hector Pintus, F-06610 La Gaude, France

   

  Active substance	Soraprazan
  Medicine Name
  Disease/condition	Treatment of Stargardt’s disease
  Date of decision	13/11/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1208
  Sponsor:	Katairo GmbH Lederstrasse 21, 72127 Kusterdingen, Deutschland

   

  Active substance	Antisense oligonucleotide targeting exon 13 in the USH2A gene
  Medicine Name
  Disease/condition	Treatment of retinitis pigmentosa
  Date of decision	23/08/2017
  Outcome	Positive
  Orphan decision number	EU/3/17/1899

• Achromatopsia

  Active substance	Recombinant adeno-associated viral vector expressing the human CNGA3 gene
  Medicine Name
  Disease/condition	Treatment of achromatopsia caused by mutations in the CNGA3 gene
  Date of decision	09/10/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1556
  Sponsor:	TMC Pharma Services Ltd Lodge Farm Barn, Elvetham Park Estate, Fleet Road, Hartley Wintney, Hampshire RG27 8AS, United Kingdom

   

  Active substance	Recombinant adeno-associated viral vector containing the human CNGB3 gene
  Medicine Name
  Disease/condition	Treatment of achromatopsia caused by mutations in the CNGB3 gene
  Date of decision	08/02/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1099
  Sponsor:	TMC Pharma Services Ltd Lodge Farm Barn, Elvetham Park Estate, Fleet Road, Hartley Wintney, Hampshire RG27 8AS, United Kingdom

• Optic neuritis

  Active substance	N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)-propyl]-carbamoyl}-methyl)-2-[2-(2-fluoro-phenyl)-ethylamino]-N-isobutyl-acetamide
  Medicine Name
  Disease/condition	Treatment of optic neuritis
  Date of decision	31/03/2014
  Outcome	Positive
  Orphan decision number	EU/3/14/1248
  Sponsor	Bionure Farma SL Dalmases 27, Local 1, 08017 Barcelona, España

   

  Active substance	Humanised anti-IL-6 receptor monoclonal antibody
  Medicine Name
  Disease/condition	Treatment of neuromyelitis optica spectrum disorders
  Date of decision	27/06/2016
  Outcome	Positive
  Orphan decision number	EU/3/16/1680

   

  Active substance	Eculizumab
  Medicine Name
  Disease/condition	Treatment of neuromyelitis optica
  Date of decision	05/08/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1185

   

  Active ingredient	Inebilizumab
  EU orphan designation number	EU/3/17/1856
  Indication	Treatment of neuromyelitis optica spectrum disorders
  Sponsor	AstraZeneca AB SE-151 85 Södertälje, Sverige

   

   

• Leber's hereditary optic neuropathy

  Active substance	Adeno-associated viral vector containing the human NADH-dehydrogenase-4 gene
  Medicine Name
  Disease/condition	Treatment of Leber's hereditary optic neuropathy
  Date of decision	13/05/2011
  Outcome	Positive
  Orphan decision number	EU/3/11/860
  Sponsor:	GenSight- Biologics 74 rue du Faubourg Saint-Antoine, 75012 Paris, France

   

  Active substance	Idebenone
  Medicine Name
  Disease/condition	Treatment of Leber's hereditary optic neuropathy
  Date of decision	15/02/2007
  Outcome	Positive
  Orphan decision number	EU/3/07/434
  EU Centralised marketing authorisation:	A centralised EU marketing authorisation has been obtained under the name Raxone on 08/09/2015 with the number EU/1/15/1020
  Sponsor:	Santhera Pharmaceuticals (Deutschland) GmbH Marie-Curie Strasse 24, D-79539 Lörrach, Deutschland

   

• Leber's congenital amaurosis

  Active substance	9-cis-Retinyl acetate
  Medicine Name
  Disease/condition	Treatment of Leber’s congenital amaurosis
  Date of decision	13/05/2011
  Outcome	Positive
  Orphan decision number	EU/3/11/861
  Sponsor:	QLT Ophthalmics (UK), Ltd c/o Hackwood Secretaries Limited, One Silk Street, London EC2Y 8HQ, United Kingdom

   

  Active substance	Adeno-associated viral vector serotype 8 containing the human GUCY2D gene
  Medicine Name
  Disease/condition	Treatment of Leber’s congenital amaurosis
  Date of decision	26/03/2014
  Outcome	Positive
  Orphan decision number	EU/3/14/1256
  Sponsor:	Fondazione Telethon Via Varese 16, 00185 Roma, Italia

   

  Active substance	Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene
  Medicine Name
  Disease/condition	Treatment of Leber’s congenital amaurosis
  Date of decision	02/04/2012
  Outcome	Positive
  Orphan decision number	EU/3/12/981
  Sponsor:	Alan Boyd Consultants Ltd Electra House, Crewe Business Park, Crewe, Cheshire CW1 6GL, United Kingdom

   

  Active substance	Adenovirus associated viral vector serotype 4 containing the human RPE65 gene
  Medicine Name
  Disease/condition	Treatment of leber's congenital amaurosis
  Date of decision	22/10/2007
  Outcome	Positive
  Orphan decision number	EU/3/07/484
  Sponsor:	HORAMA SAS 9 rue de l'Eperon, 75006 Paris, France

   

  EU orphan designation number:	EU/3/15/1577
  Active ingredient:	Adenovirus associated viral vector serotype 5 containing the human RPE65 gene
  Indication:	Treatment of Leber’s congenital amaurosis
  Sponsor:	Athena Vision Ltd c/o UCL Business PLC The Network Building, 97 Tottenham Court Road, London W1T 4TP, United Kingdom

   

  Active substance	Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA
  Medicine name
  Disease / condition	Treatment of Leber’s congenital amaurosis
  Date of decision	28/04/2016
  Outcome	Positive
  Orphan decision number	EU/3/16/1641

   

  Active substance	Recombinant adeno-associated viral vector serotype 5 encoding Staphylococcus aureus Cas9 endonuclease and two guide RNAs complementary to two regions of intron 26 of the CEP290 gene
  Medicine name
  Disease / condition	Treatment of Leber’s congenital amaurosis
  Date of decision	6/10/2017
  Sponsor	Pharma Gateway AB  Johanneslundsvägen 2, Oxfordhuset, 194 61 Upplands Väsby, Sverige
  Orphan decision number	EU/3/17/1928

• Uveitis

  Active substance	3-{[2,3,5,6-tetrafluoro-3'-(trifluoromethoxy)biphenyl-4-yl]carbamoyl}thiophene-2-carboxylic acid
  Medicine Name
  Disease/condition	Treatment of non-infectious uveitis
  Date of decision	19/06/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1507
  Sponsor:	Panoptes Pharma Ges.m.b.H Am Heumarkt 7/39, 1030 Vienna, Österreich

   

  Active substance	Autologous collagen type II-specific regulatory T cells
  Medicine Name
  Disease/condition	Treatment of non-infectious uveitis
  Date of decision	16/12/2014
  Outcome	Positive
  Orphan decision number	EU/3/14/1405
  Sponsor:	TxCell Allée de la Nertière - Les Cardoulines, F-06560 Valbonne - Sophia Antipolis, France

   

  Active substance	Fluocinolone acetonide (prolonged-release intravitreal implant)
  Medicine Name
  Disease/condition	Treatment of non-infectious uveitis affecting the posterior segment of the eye
  Date of decision	06/03/2005
  Outcome	Positive
  Orphan decision number	EU/3/05/261
  Sponsor:	Bausch & Lomb Ireland IDA Industrial Park, Waterford, Ireland

   

  Active substance	Gevokizumab
  Medicine Name
  Disease/condition	Treatment of chronic non-infectious uveitis
  Date of decision	12/03/2013
  Outcome	Positive
  Orphan decision number	EU/3/13/1111
  Sponsor:	Les Laboratoires Servier 50 rue Carnot, F-92284 Suresnes CEDEX, France

   

  Active substance	Sirolimus
  Medicine Name
  Disease/condition	Treatment of chronic non-infectious uveitis
  Date of decision	30/08/2011
  Outcome	Positive
  Orphan decision number	EU/3/11/898

   

  Active substance	Triamcinolone acetonide
  Medicine Name
  Disease/condition	Treatment of non-infectious uveitis
  Date of decision	21/05/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1490
  Sponsor:	S-cubed Ltd 99 Park Drive, Milton Park, Abingdon, Oxfordshire OX14 4RY, United Kingdom

   

  Active substance	Voclosporin
  Medicine Name
  Disease/condition	Treatment of non-infectious uveitis
  Date of decision	06/12/2012
  Outcome	Positive
  Orphan decision number	EU/3/12/1085
  Sponsor:	Granzer Regulatory Consulting & Services Zielstattstr. 44, D-81379 Munich, Deutschland

   

  Active substance	DNA plasmid encoding a recombinant fusion protein consisting of the extracellular domain of human TNFα p55 receptor linked to the human IgG1 Fc domain
  Medicine name
  Disease / condition	Treatment of non-infectious uveitis
  Date of decision	17/02/2016
  Outcome	Positive
  Orphan decision number	EU/3/16/1619

   

  Active substance	Fluocinolone acetonide
  Medicine name
  Disease / condition	Treatment of non-infectious uveitis
  Date of decision	28/04/2016
  Outcome	Positive
  Orphan decision number	EU/3/16/1647

   

• Others

  Active substance	(1S,4R,5R,7S)-3,4-dibenzyl-2-oxo-6,8-dioxa-3-azabyciclo[3.2.1]octane-7-carboxylic acid-L-lysine
  Medicine Name
  Disease/condition	Treatment of neurotrophic keratitis
  Date of decision	16/12/2014
  Outcome	Positive
  Orphan decision number	EU/3/14/1400
  Sponsor:	MIMETECH S.r.l. Via di Vigna Stelluti 157, 0091 Roma, Italia

   

  Active substance	4-(4-Methoxy-phenylamino)-6-methylcarbamyl-quinoline-3-carboxylic acid
  Medicine Name
  Disease/condition	Prevention of scarring post glaucoma filtration surgery
  Date of decision	04/06/2014
  Outcome	Positive
  Orphan decision number	EU/03/14/1279
  Sponsor:	Clanotech AB Fogdevreten 2, Solna S-171 65, Sverige

   

  Active substance	Adeno-associated viral vector serotype 2 containing the human REP1 gene
  Medicine Name
  Disease/condition	Treatment of choroideraemia
  Date of decision	04/07/2014
  Outcome	Positive
  Orphan decision number	EU/3/14/1290
  Sponsor:	NightstaRx Ltd. 215 Euston Road, London NW1 2BE, United Kingdom

   

  Active substance	Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1
  Medicine Name
  Disease/condition	Treatment of choroideraemia
  Date of decision	04/06/2014
  Outcome	Positive
  Orphan decision number	EU/03/14/1278
  Sponsor:	Alan Boyd Consultants Ltd Electra House, Crewe Business Park, Crewe, Cheshire CW1 6GL, United Kingdom

   

  Active substance	Adeno-associated viral vector serotype 5 containing the human CHM gene
  Medicine Name
  Disease/condition	Treatment of choroideremia
  Date of decision	24/04/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1482
  Sponsor:	HORAMA SAS 9 rue de l'Eperon, 75006 Paris, France

   

  Active substance	Aganirsen
  Medicine Name
  Disease/condition	Treatment of central retinal vein occlusion
  Date of decision	10/06/2014
  Outcome	Positive
  Orphan decision number	EU/03/14/1275
  Sponsor:	Gene Signal SAS 4 rue Pierre Fontaine, F-91000 Evry, France

   

  Active substance	Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
  Medicine Name
  Disease/condition	Prevention of corneal graft rejection
  Date of decision	17/04/2007
  Outcome	Positive
  Orphan decision number	EU/3/07/445
  Sponsor:	Gene Signal SAS 4 rue Pierre Fontaine, F-91000 Evry, France

   

  Active substance	Ciclosporin
  Medicine Name
  Disease/condition	Prevention of corneal graft rejection
  Date of decision	22/10/2007
  Outcome	Positive
  Orphan decision number	EU/3/07/455
  Sponsor:	SANTEN SAS Bât Genavenir IV, 1 rue Pierre Fontaine, F- 91058 Evry CEDEX, France

   

   

  Active substance	Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
  Medicine Name
  Disease/condition	Treatment of retinopathy of prematurity
  Date of decision	02/10/2003
  Outcome	Positive
  Orphan decision number	EU/3/03/160
  Sponsor:	Gene Signal SAS 4 rue Pierre Fontaine, F-91000 Evry, France

   

  Active substance	Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
  Medicine Name
  Disease/condition	Treatment of neovascular glaucoma
  Date of decision	02/10/2003
  Outcome	Positive
  Orphan decision number	EU/3/03/161
  Sponsor:	Gene Signal SAS 4 rue Pierre Fontaine, F-91000 Evry, France

   

  Active substance	Ataluren
  Medicine Name
  Disease/condition	Treatment of aniridia
  Date of decision	09/10/2015
  Outcome	Positive
  Orphan decision number	EU/3/15/1561
  Sponsor:	PTC Therapeutics International Limited 77 Sir John Rogerson’s Quay, Dublin 2, Ireland

   

  Active substance	Ciclosporin
  Medicine Name
  Disease/condition	Treatment of vernal keratoconjunctivitis
  Date of decision	06/04/2006
  Outcome	Positive
  Orphan decision number	EU/3/06/360
  Sponsor:	SANTEN SAS Bât Genavenir IV, 1 rue Pierre Fontaine, F- 91058 Evry CEDEX, France

   

  Active substance	Ciclosporin (eye drops, solution)
  Medicine Name
  Disease/condition	Treatment of atopic keratoconjunctivitis
  Date of decision	24/07/2009
  Outcome	Positive
  Orphan decision number	EU/3/09/651
  Sponsor:	Allergan Pharmaceuticals Ireland Castlebar Road, Westport, County Mayo, Ireland

   

  Active substance	Ciclosporin
  Medicine Name
  Disease/condition	Treatment of herpes simplex virus stromal keratitis
  Date of decision	28/10/2007
  Outcome	Positive
  Orphan decision number	EU/3/07/489
  Sponsor:	SANTEN S.A.S. Bâtiment Genavenir IV, 1 rue Pierre Fontaine, F-91058 Evry Cedex, France

   

   

  Active substance	Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotropic factor
  Medicine Name
  Disease/condition	Treatment of macular telangiectasia type 2
  Date of decision	08/11/2012
  Outcome	Positive
  Orphan decision number	EU/3/12/1072
  Sponsor:	Enpharma Ltd North House, Farmoor Court, Cumnor Road, Oxford, OX2 9LU, United Kingdom

   

  Active substance	Ex-vivo-expanded autologous human corneal epithelium-containing stem cells
  Medicine Name	Holoclar
  Disease/condition	Corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns
  Date of decision	06/11/2008
  Outcome	Positive
  Orphan decision number	EU/3/08/579
  Sponsor:	Chiesi Farmaceutici S.P.A. Via Palermo 26/A, 43122 Parma, Italia
  EU Centralised marketing authorisation:	A centralised EU marketing authorisation has been obtained under the name Holoclar on 17/02/2015 with the number EU/1/14/987

   

  Active substance	Mecasermin rinfabate
  Medicine Name
  Disease/condition	Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age
  Date of decision	28/08/2006
  Outcome	Positive
  Orphan decision number	EU/3/06/399
  Sponsor:	Premacure AB Dag Hammarskjölds väg 60, SE-751 83 Uppsala, Sverige

   

  EU orphan designation number:	EU/3/15/1586
  Active ingredient:	Recombinant human nerve growth factor
  Indication:	Treatment of neurotrophic keratitis
  Sponsor:	Dompé farmaceutici S.p.A. Via San Martino, 12-12/a, 20122 Milano, Italia

   

  Active substance	Retinol
  Medicine Name
  Disease/condition	Prevention of retinopathy of prematurity
  Date of decision	17/07/2017
  Outcome	Positive
  Orphan decision number	EU/3/17/1895

   

  Active substance	Inebilizumab
  Medicine Name
  Disease/condition	Treatment of neuromyelitis optica spectrum disorders
  Date of decision	20/03/2017
  Outcome	Positive
  Orphan decision number	EU/3/17/1856